Ebola virus sequencing protocol

Nanopore | amplicon | native barcoding

Document: ARTIC-EBOV-seqSOP-v1.0.0
Creation Date: 2018-05-17
Revision Date: 2018-05-27
Forked from: doi:10.1038/nprot.2017.066
Author: Luke Meredith
Licence: Creative Commons Attribution 4.0 International License
Overview: The following protocol is adapted from the methods of Quick et al. (2017) Nature Protocols 12: 1261–1276 doi:10.1038/nprot.2017.066 and covers primers, amplicon preparation and clean-up, then uses a single-tube protocol to barcode and adaptor ligate the library, before running minION.


This document is part of the Ebola virus Nanopore sequencing protocol package:
http://artic.network/ebov/
Ebola primer scheme:
https://github.com/artic-network/primer-schemes/tree/master/ZaireEbola/V2
Ebola virus Nanopore sequencing protocol:
http://artic.network/ebov/ebov-seq-sop.html
Ebola virus Nanopore sequencing kit-list:
http://artic.network/ebov/ebov-seq-kit.html




Funded by the Wellcome Trust
Collaborators Award 206298/Z/17/Z --- ARTIC network

Preparation

Equipment required:

2 Portable nucleic acid preparation hood or equivalent
1 12V vortex
1 Sprout® portable centrifuge
1 1mL Eppendorf pipette
1 0.1mL Eppendorf pipette
1 0.01L Eppendorf pipette
1 1.5mL/0.6mL convertible tube rack
1 Qubit 4 Fluorometer (ThermoFisher™)
1 miniPCR machine.
1 Heat block
1 magnetic rack

Consumables required:

  Vilo SSIV RT 2x MasterMix
  Q5 Hotstart HF polymerase 2x Mastermix
  Ebola Zaire Primers V1
  NEBNext UltraII End-prep module
  NEBNext UltraII Ligase module
  NEBNext FFPE Repair module
  Agencourt AMPureXP Beads
  Nanopore Ligation Sequencing Kit 1D
  Nanopore Native Barcoding Expansion Kit
  Nanopore R9.4.1 Flow cells
  1.5mL eppendorf tubes
  0.2mL 8-strip tubes
  50mL transfer tubes
  Qubit Reaction Tubes
  Qubit 1x dsDNA HS Assay kit
  Nuclease-free water
  70% Ethanol
  1mL pipette tips
  0.1mL pipette tips
  0.01mL pipette tips
  Paper towelling
  Clinical waste sharps containers

Safety, containment and contamination recommendations

  Back-tie hydrophobic lab gown
  Gloves
  UV light sterilizers
  MediPal Decontamination wipes
  DNAway and RNAse Zap® reagent

Protocol

Part 1: cDNA synthesis with Superscript IV Vilo cDNA kit

NOTE ON HOOD PREPARATION: To prevent cross contamination of both the sample and other reagents, this should be carried out in the SAMPLE PREPARATION HOOD, which is pre-sterilised with UV and treated with MediPal wipes, DNAway and RNAseZap reagent. Wipe down the hood with each sequentially, allowing 5 minutes for drying between each. Pipettes should also be treated in the same way, and UV treated for 30 mins between library preparations.

  1. Recommend aliquoting the Vilo mastermix, to prevent cross contamination and to reduce potential freeze/thaw cycles.
  2. Set up the following reaction:

    2x Vilo Master Mix 5µL
    viral RNA 5µL
    TOTAL 10µL

NOTE: Viral RNA input from a clinical sample should be between Ct 18-35. If Ct is between 12-15, then dilute the sample 100-fold in water, if between 15-18 then dilute 10-fold in water. This will reduce the likelihood of PCR-inhibition.

  1. Gently mix (avoid vortexing) then pulse spin the tube to ensure maximum contact with the thermal cycler.
  2. Incubate the reaction as follows:

    Primer annealing 25°C 20 mins
    Extension 50°C 30 mins
    Inactivation 85°C 10 mins
  3. cDNA is now ready for amplicon generation.

Part 2: Ebola Amplicon Preparation

NOTE ON HOOD PREPARATION: To prevent cross contamination of both the sample and other reagents, this should be carried out in the MASTERMIX HOOD, which is pre-sterilised with UV and treated with MediPal wipes, DNAway and RNAseZap reagent. Wipe down the hood with each sequentially, allowing 5 minutes for drying between each. Pipettes should also be treated in the same way, and UV treated for 30 mins between library preparations.

Primer dilution and preparation

  1. Ebola primers for this protocol were designed using Primal Scheme and generate 400nt amplicons with 75nt overlaps. Primer names and dilutions are listed in the table below.

  2. Primers should be prepped and aliquoted PRIOR TO DEPARTURE in a STERILE PCR CABINET. At NO stage should primers or PCR reagents be anywhere near the template or amplicons until use.

  3. Resuspend lyophilised primers at a concentration of 100µM each

  4. Generate primer pool stocks by adding 20µL of each primer pair to a 1.5mL Eppendorf labelled “Pool 1, 100µM” or “Pool 2, 100µM”. Total volume should be 480µL of Pool 1 and 460µL of Pool 2. This is a 10x stock of each primer pool.

  5. Dilute this primer pool 1:10 in molecular grade water, to generate 10µM primer stocks. Recommend that at least 1mL of each primer pool is taken in 100µL aliquots, to account for any risks of degradation of contamination.

NAME Sequence NAME Sequence Pool [Stock]
EBOV_1_LEFT TGTGTGCGAATAACTATGAGGAAGAT EBOV_1_RIGHT TCAGATTCAGTGAGACTCGGCG 1 100µM
EBOV_2_LEFT AAAGACAAATTGCTCGGAATCACAA EBOV_2_RIGHT CAAAGGAGAGAAACTGACCGGC 2 100µM
EBOV_3_LEFT AAGAGAACACTTGCTGCCATGC EBOV_3_RIGHT CATACTCTCCATGCTTGGCCAG 1 100µM
EBOV_4_LEFT AGTTCGTCTCCATCCTCTTGCA EBOV_4_RIGHT TCCTGGAAAGGGAATGTCGTCA 2 100µM
EBOV_5_LEFT GAAGCTATCACTGCTGCGTCAC EBOV_5_RIGHT TAATTGGTGTCAGCATGCGAGG 1 100µM
EBOV_6_LEFT CCTCACAGAACAATCCACCACG EBOV_6_RIGHT TCTTTTTCAGTGAGCCATGGTGG 2 100µM
EBOV_7_LEFT CAGTGATGGCAAAGAGTACACGT EBOV_7_RIGHT AATGTTGGGCAGGCTAGTAGGT 1 100µM
EBOV_8_LEFT CCACAGTTATAGCCATAATTGTAACTCAAT EBOV_8_RIGHT TGATTGCAAATTGGGTCCGTTTG 2 100µM
EBOV_9_LEFT ACGCATCCCAAATGCAACAAAC EBOV_9_RIGHT GCCGAAATGTCAGGTTTCCCAA 1 100µM
EBOV_10_LEFT TGAGACCGTCCCTCAAAGTGTT EBOV_10_RIGHT GAGGGAAGGGAGATTGGCTCAA 2 100µM
EBOV_11_LEFT CATCGCCCAAGATTGATCGAGG EBOV_11_RIGHT AGGAAGCCTGTATTGCTGTTGC 1 100µM
EBOV_12_LEFT TTGCCTACTGCTCCTCCTGAAT EBOV_12_RIGHT GGAAGAACGAACTCCTGGAGGA 2 100µM
EBOV_13_LEFT CTTGTCAGAGTCAATCGGCTGG EBOV_13_RIGHT GTCCAACCCAATGTACTTTGGCA 1 100µM
EBOV_14_LEFT TCCACAAGCTGACCGGTAAGAA EBOV_14_RIGHT AGCATGCAGGCAATTTGAGGAT 2 100µM
EBOV_15_LEFT ACGGTGATTCAAATGTTAATCTTTCTCAT EBOV_15_RIGHT AGTTTGTCGACATCACTAACCTGT 1 100µM
EBOV_16_LEFT AGAACATTTTCCATCCCACTTGGA EBOV_16_RIGHT TTGGGGCAGTATCAGAAATGCA 2 100µM
EBOV_17_LEFT TGATCGACTTGCTTCCACAGTT EBOV_17_RIGHT CCGGACTCTGACCACTGATGTT 1 100µM
EBOV_18_LEFT ACCTCACTAGAAAAATTCGCAGTGA EBOV_18_RIGHT TTTTGGGGACTTGTTGTGGTGG 2 100µM
EBOV_19_LEFT CCCCAAAAGCAGAGAACACCAA EBOV_19_RIGHT CGGTTGAGGATTGAAAAGGTGC 1 100µM
EBOV_20_LEFT CCAACGAGACGACTCAAGCTCT EBOV_20_RIGHT TGGCTATGTTTAAAGCTCCAGTGT 2 100µM
EBOV_21_LEFT AGCCTCAAATCAATGAAACCAGGA EBOV_21_RIGHT TGGTCGTGTCCATCCCTTGAAT 1 100µM
EBOV_22_LEFT GCTTCATATGAGAGAGGACGCC EBOV_22_RIGHT GGTTCTGATGTCTTGTCTCGCC 2 100µM
EBOV_23_LEFT ATCCAACGGCTGATGATTTCCAG EBOV_23_RIGHT ACCCTCATCAGACCATGAGCAT 1 100µM
EBOV_24_LEFT CTGCTGTCGTTGTTTCAGGGTT EBOV_24_RIGHT ACACCTCCTCCACAGCTTGAAG 2 100µM
EBOV_25_LEFT GCAACGATCCATCCCATCAAAAA EBOV_25_RIGHT TTTCAGCCAATGGAGTTGACCTG 1 100µM
EBOV_26_LEFT GGGGCAATAATATCTAATTGAACTTAGCC EBOV_26_RIGHT AGAGATTCCTTGTTATTGACCATGCAG 2 100µM
EBOV_27_LEFT GTGACTCACAAAGGAATGGCCC EBOV_27_RIGHT CGATTTGTCGGGTTCTTGGAGC 1 100µM
EBOV_28_LEFT CGGATTGTTGAGCAGTATTGAAATTGG EBOV_28_RIGHT AGCAATTCTATGATGTTGTCTTGGAATCT 2 100µM
EBOV_29_LEFT TCCTCACTGTAAGCCAGCTTCC EBOV_29_RIGHT TTTCGGGAGTTTACAGTTGCGT 1 100µM
EBOV_30_LEFT CTAGTCACTAGAGCTTGCGGGT EBOV_30_RIGHT AGTCCCCATAGCCTAAGATGTCT 2 100µM
EBOV_31_LEFT CTGGCTATTTTAACTCGAAGGGGT EBOV_31_RIGHT AAGAATCGGCCCTTCCTCTCAG 1 100µM
EBOV_32_LEFT AAGTTCCTCGAACCATTGTGCTT EBOV_32_RIGHT TCATTGGCAACGGAGGGAATTG 2 100µM
EBOV_33_LEFT TGATAGTCAAGGATCTTGGTACAGTGT EBOV_33_RIGHT AGCAAGACCATCAGCTAACAGAG 1 100µM
EBOV_34_LEFT AATTGCCTTATCCGACTCGCAA EBOV_34_RIGHT TGAGCACATGAAATACTTGTCCAGA 2 100µM
EBOV_35_LEFT AAGGGCCTAGTTCATACAGGGG EBOV_35_RIGHT CTGCAAGGAAAGATATGTCGTGTCT 1 100µM
EBOV_36_LEFT ATCTTCAAGGGACCCTGGCTAG EBOV_36_RIGHT CTTAGGGTGATGGTCCTGCGTA 2 100µM
EBOV_37_LEFT GCGGATTAAATGTCCCTGGGTC EBOV_37_RIGHT TGGCTCCAATAAGAGGTCTTCCC 1 100µM
EBOV_38_LEFT GCGGAGGCTTTAACCCAAATAACT EBOV_38_RIGHT TTCCTGAGTAATGTGAAGGGGTCA 2 100µM
EBOV_39_LEFT GCAGTTCGAACAGTGACTTGCT EBOV_39_RIGHT ATGAGATATTGCAATTGAGTCCTCCT 1 100µM
EBOV_40_LEFT TAACAAGATACCGAGAAAACGAATTGATT EBOV_40_RIGHT TGAGGATCAATACTCATTAACCGTGAC 2 100µM
EBOV_41_LEFT GCTCATTGCGAATACTTAAGCCAAC EBOV_41_RIGHT TGTGCTTGATCCAGTTGAAGAGT 1 100µM
EBOV_42_LEFT CATGCATCATTGGCGTACTGGA EBOV_42_RIGHT CGGATCTCAATTGCCGTAAGTACT 2 100µM
EBOV_43_LEFT GGGACACGCCAATTAACGTCAT EBOV_43_RIGHT TCTGTTGTCTCTGCATCCATGG 1 100µM
EBOV_44_LEFT AGACCAAAGAGCAAGGCTACCT EBOV_44_RIGHT CCTGTGGTATAGTACTTTCTCTAATGATGG 2 100µM
EBOV_45_LEFT ACTCAGTATGCTGACTGTGAGTTACA EBOV_45_RIGHT TAAACTCAGAAGCCCTGTCAGC 1 100µM
EBOV_46_LEFT AGATTGCAATTGTGAAGAACGTTTCT EBOV_46_RIGHT TCAACCAAAACACTATTCCATCTGACA 2 100µM
EBOV_47_LEFT GCCGCAATGAATTTAACGCAACA EBOV_47_RIGHT TGTGTGCGACCATTTTTCCAGG 1 100µM

NOTE: Primers need to be used at a final concentration of 0.015µM per primer. In this case, Pool 1 has 48 primers in it so the requirement is 1.8µL of 10µM primer Pool 1 per 25µL reaction. Pool 2 has 46 primers so needs 1.72µL of primer Pool 2 per 25µL reaction. For other schemes, adjust the volume added appropriately.

  1. Set up the amplicon PCR reactions as follows in 0.5mL thin-walled PCR or strip-tubes:

    Reagent POOL 1 POOL 2
    NEB Q5® Polymerase 2X MasterMix 12.5µL 12.5µL
    Primer Pool 1 or 2 (10µM) 1.8µL 1.72µL
    Water 6.7µL 6.78µL
    TOTAL 21µL 21µL

NOTE: This should be carried out in the mastermix hood and cDNA should not be taken anywhere near the mastermix hood at any stage.

  1. In the TEMPLATE HOOD add 4µL of cDNA to each Pool1 and Pool2 reaction mix and mix well.

  2. Pulse centrifuge the tubes to remove any contents from the lid.

  3. Set up the cycling conditions as follows:

      Temperature Time Cycles
    Heat Activation 98°C 30 seconds 1
    Denaturation 98°C 15 seconds 35
    Annealing 65°C 300 seconds .
    Hold 4°C Indefinite 1
  4. Clean-up the amplicons using the following protocol in the TEMPLATE HOOD:

    1. Combine the entire contents of “Pool1” and “Pool2” PCR reactions for each biological sample into to a single 1.5mL Eppendorf tube.

    2. Mix sample gently, avoid vortexing.

    3. Ensure AmpureXP beads are well resuspended by thoroughly mixing prior to addition to the sample. Mixture should be a homogenous brown colour.

    4. Add an equal volume of AmpureXP beads to the tube and mix gently by either flicking or pipetting. This should be approximately 50µL, so add 50µL of beads.

    5. Pulse centrifuge the tubes to remove any beads or solution from the lid or side of the tube.

    6. Incubate for 2 mins at 25°C.

    7. Place on magnetic rack and incubate for 2 mins or until the beads have pelleted against the magnet and the solution is completely clear.

    8. Carefully remove and discard the solution, being careful not to displace the bead pellet.

    9. Add 200µL of room-temperature 70% ethanol to the pellet.

    10. Remove from magnet and mix by gently flicking the tube.

    11. Pulse centrifuge the tube to make sure all the mixture is out of the lid following flicking, then place back onto the magnet.

    12. Incubate for 2 mins or until the beads have pelleted against the magnet and the solution is completely clear.

    13. Carefully remove and discard ethanol, being careful not to displace the bead pellet.

    14. Repeat steps h to m to wash the pellet again.

    15. Briefly pulse centrifuge the pellet and carefully remove as much ethanol as possible using a 10µL tip.

    16. Allow the pellet to dry for 2 mins, being careful not to overdry (if the pellet is cracking, then it is too dry).

    17. Resuspend pellet in 30µL of water, and incubate for 2 mins.

    18. Place on magnet and CAREFULLY remove water and transfer to a clean 1.5mL Eppendorf tube. MAKE SURE that no beads are transferred into this tube. In some cases a pulse centrifugation can be used to pellet residual beads.

    19. Quantify the amplicon library using Qubit4™ following the dsDNA protocol.

Part 3: Qubit Quantification of Nucleic Acid: dsDNA

  1. Set up the required number of 0.5mL tubes for standards and samples. The Qubit™ 1X dsDNA HS Assay requires 2 standards.

NOTE: Use only thin-wall, clear, 0.5mL PCR tubes. Acceptable tubes include Qubit™ assay tubes (Cat. No. Q32856)

  1. Label the tube lids. Do not label the side of the tube as this could interfere with the sample read. Label the lid of each standard tube correctly. Calibration of the Qubit™ Fluorometer requires the standards to be inserted into the instrument in the right order

  2. Add 10µL of each Qubit™ standard to the appropriate tube.

  3. Add 1–20µL of each user sample to the appropriate tube.

NOTE: If you are adding 1–2µL of sample, use a P-2 pipette for best results.

  1. Add the Qubit™ 1X dsDNA 1X buffer to each tube such that the final volume is 200µL.

NOTE: The final volume in each tube must be 200µL. Each standard tube requires 190µL of Qubit™ working solution, and each sample tube requires anywhere from 180–199µL. Ensure that you have sufficient Qubit™ working solution to accommodate all standards and samples.

NOTE: To avoid any cross-contamination, we recommend that you remove the total amount of working solution required for your samples and standards from the working solution bottle and then add the required volume to the appropriate tubes instead of pipetting directly from the bottle to each tube.

  1. Mix each sample vigorously by vortexing for 3–5 seconds.

  2. Allow all tubes to incubate at room temperature for 2 minutes, then proceed to “Read standards and samples”.

  3. On the Home screen of the Qubit™ 4 Fluorometer, press DNA, then select 1X dsDNA HS as the assay type. The Read standards screen is displayed. Press Read Standards to proceed.

NOTE: If you have already performed a calibration for the selected assay, the instrument prompts you to choose between reading new standards and running samples using the previous calibration. If you want to use the previous calibration, skip to step 11. Otherwise, continue with step 9.

  1. Insert the tube containing Standard #1 into the sample chamber, close the lid, then press Read standard. When the reading is complete (~3 seconds), remove Standard #1.

  2. Insert the tube containing Standard #2 into the sample chamber, close the lid, then press Read standard. When the reading is complete, remove Standard #2.

  3. The instrument displays the results on the Read standard screen. For information on interpreting the calibration results, refer to the Qubit™ Fluorometer User Guide, available for download at thermofisher.com/qubit.

  4. Press Run samples.

  5. On the assay screen, select the sample volume and units:

    • Press the + or buttons on the wheel, or anywhere on the wheel itself, to select the sample volume added to the assay tube (from 1–20µL).

    • From the unit dropdown menu, select the units for the output sample concentration.

  6. Insert a sample tube into the sample chamber, close the lid, then press Read tube. When the reading is complete (~3 seconds), remove the sample tube.

  7. The top value (in large font) is the concentration of the original sample and the bottom value is the dilution concentration. For information on interpreting the sample results, refer to the Qubit™ Fluorometer User Guide.

  8. Repeat step 14 until all samples have been read.

  9. Carefully record all results and store run file from the Qubit on a memory stick.

Part 4: Barocoding and adaptor ligation: One-pot protocol.

NOTE: This is a ‘one-pot ligation’ protocol for native barcoded ligation libraries. We have seen no reduction in performance compared to standard libraries, and is made faster by using the Ultra II® ligation module which is compatible with the Ultra II® end repair/dA-tailing module removing a clean-up step. If you have the time I would recommend using the double incubation times in blue, if you are in a hurry the times in red are a good compromise between speed and efficiency.

  1. Set up the following end-prep reaction for each biological sample:

    DNA (500 ng) 25µL
    Ultra II End Prep Reaction Buffer 3.5µL
    Ultra II End Prep Enzyme Mix 1.5µL
    Total 30µL

NOTE: Amount of RNA can vary from 250-1000ng, less than this and the coverage and depth may be sub-optimal.

  1. Incubate at RT for 5 mins or 10 mins then 65°C for 5 mins or 10 mins

  2. Place on ice for 30 secs

  3. Add the following directly to the previous reactions:

    NBXX barcode 2.5µL
    Ultra II Ligation Master Mix 20µL
    Ligation Enhancer 1µL
    Total 53.5µL

NOTE: Use a SINGLE barcode per biological sample.

  1. Incubate at RT for 10 mins or 20 mins, 70°C for 5 mins then place on ice.

  2. Pool all barcoded fragments together into a clean 1.5 ml Eppendorf tube

  3. Add 53µL Ampure XP beads per sample.

  4. Incubate for 5 mins or 10 mins.

  5. Place on a magnet rack until clear.

  6. Remove solution.

  7. Add 200µL 80% ethanol to the tube still on the magnetic rack.

  8. Incubate 30 secs.

  9. Remove solution.

  10. Repeat last three steps (11-13).

  11. Spin down and remove residual 70% ethanol and air dry for 1 min.

  12. Resuspend in 31µL EB.

  13. Incubate off the magnetic rack for 5 mins or 10 mins mins.

  14. Replace on magnetic rack.

  15. Incubate for 2 mins at room temperature and then carefully remove solution and transfer to a clean 1.5mL Eppendorf tube.

  16. Remove 1µL and assess concentration by Qubit as described in previous section.

  17. Set up the following adapter ligation reaction:

    Cleaned-up barcoded fragments (~3µg) 30.0µL
    BAM 1D 20.0µL
    Ultra II Ligation module 40.0µL
    Ultra II Ligation enhancer 1.0µL
    Total volume 91.0µL
  18. Incubate at RT for 10 mins or 20 mins.

  19. Add 45.5µL Ampure XP beads

  20. Incubate for 5 mins or 10 mins mins

  21. Place on a magnetic rack until clear

  22. Remove supernatant

  23. Add 150µL ABB and resuspend by flicking

CAUTION: do not use 80% ethanol

  1. Place on magnetic rack until clear

  2. Remove supernatant

  3. Repeat ABB wash

  4. Spin down and remove residual ABB

  5. Add 12µL ELB and resuspend by flicking

  6. Incubate at RT for 5 mins or 10 mins

  7. Place on magnetic rack

  8. Carefully transfer solution to a clean 1.5mL Eppendorf tube.

  9. Remove 1µL and assess concentration by Qubit (wait until beads have settled before measuring).

NOTE: Library can be now be stored at -20oC if required, but for best results it would be best to proceed immediately to sequencing.

Part 5: Priming and loading the SpotON flow cell

  1. Thaw the following:
    • ABB Buffer (ABB) at RT

    • Library loading beads (LLB) at RT
 

    • Running Buffer with Fuel Mix (RBF) on ice
  2. Thoroughly mix the contents of the RBF and LLB tubes by pipetting.

  3. Flip back the MinION lid and slide the priming port cover clockwise so that the priming port is visible.

IMPORTANT: Care must be taken when drawing back buffer from the flow cell. The array of pores must be covered by buffer at all times. Removing more than 20-30µL risks damaging the pores in the array.

  1. After opening the priming port, check for small bubble under the cover. Draw back a small volume to remove any bubble (a fewµLs):
    • Set a P1000 pipette to 200µL
    • Insert the tip into the priming port
    • Turn the wheel until the dial shows 220-230µL, or until you can see a small volume of buffer entering the pipette tip.
  2. Prepare the flow cell priming mix in a clean 1.5 ml Eppendorf tube. Avoid introducing bubbles at this stage to ease the next step.

    RBF 576µL
    Nuclease-free water 624µL
  3. Load 800µL of the priming mix into the flow cell via the priming port, using the dial-down method described in step 5, avoiding the introduction of air bubbles.

  4. Wait for 5 minutes.

  5. In a new tube prepare the library dilution for sequencing:

    Reagent Volume
    RBF 35µL
    Nuclease-free water 3.5µL
    LLB 25.5µL
    Library 11µL
    Total 75µL
  6. Gently lift the SpotON sample port cover to make the SpotON sample port accessible.

  7. Load 200µL of the priming mix into the flow cell via the priming port (NOT the SpotON sample port), avoiding the introduction of air bubbles.

  8. Mix the prepared library gently by pipetting up and down just prior to loading.

  9. Add 75µL of sample to the flow cell via the SpotON sample port in a dropwise fashion. Ensure each drop flows into the port before adding the next.

  10. Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port, close the priming port and replace the MinION lid.

  11. Double–click the MinKNOW icon located on the desktop to open the MinKNOW GUI.

  12. If your MinION was disconnected from the computer, plug it back in.

  13. Choose the flow cell type from the selector box:

    • FLO-MIN106 : R9.4.1 flowcells

    • FLO-MIN107 : R9.5.1 flowcells

  14. Then mark the flow cell as Selected.

  15. Click the New Experiment button at the bottom left of the GUI.

  16. On the New experiment popup screen, select the running parameters for your experiment from the individual tabs:

    • Output settings - FASTQ
      The number of basecalls that MinKNOW will write in a single file. By default this is set to 4000
    • Output settings - FAST5
      The number of files that MinKNOW will write to a single folder. By default this is set to 4000
  17. Click Begin Experiment.

  18. Allow the script to run to completion.

  19. The MinKNOW Experiment page will indicate the progression of the script; this can be accessed through the Experiment tab that will appear at the top right of the screen

  20. Monitor messages in the Message panel in the MinKNOW GUI